The Korean Society Fishries And Sciences Education

Current Issue

The Journal of the Korean Society for Fisheries and Marine Sciences Education - Vol. 32 , No. 3

[ Article ]
The Journal of the Korean Society for Fisheries and Marine Sciences Education - Vol. 31, No. 5, pp.1424-1431
Abbreviation: J Kor Soc Fish Mar Edu.
ISSN: 1229-8999 (Print) 2288-2049 (Online)
Print publication date 31 Oct 2019
Received 03 Sep 2019 Revised 26 Sep 2019 Accepted 02 Oct 2019
DOI: https://doi.org/10.13000/JFMSE.2019.10.31.5.1424

참굴(Crassostrea gigas)의 배발생단계에 따른 인슐린유사성장인자 시스템의 발현
박수진 ; 최윤희
부경대학교(학생)
부경대학교(교수)

Activity of Insulin-like Growth Factor System During the Embryogenesis of Pacific Oyster(Crassostrea gigas)
Su-Jin PARK ; Youn-Hee CHOI
Pukyong National University(student)
Pukyong National University(professor)
Correspondence to : 051-629-5915, unichoi@pknu.ac.kr

Funding Information ▼

Abstract

Insulin-like growth factors(IGFs) are important in vertebrate embryogenesis and fetal growth of mammals and fish. The Pacific oyster(Crassostrea gigas) is one of the most important aquaculture species in Asia. However, the production of nature seed fluctuates widely year to year. One recent cause of this decrease is increasing seawater pollution to deal with this problem, superior seed production is needed. In particular, early seed production, which is determined by embryogenesis, is vital for aquaculture success. Therefore, this study examined the role of growth factor IGF-I activity during C. gigas embryogenesis. One-year-old cultured C. gigas obtained from Gyeongsangnam-do, Jaranman, Korea(34°51′32.34″ N, 128°12′23.44″ E) were used to collect eggs and sperm. The eggs were maintained in three 20L tanks at 23℃. Each development stage was classified as being reached when more than 80% of the embryos reached that step. C. gigas larvae were sampled at the unfertilized egg, fertilized egg, blastula, gastrula, trochophore, and D-shaped larva stages. The activity of IGF-I was high in the blastula, and IGF-I receptors decreased as development progressed. Tyrosine-phosphorylation was also similar to the expression of IGF-I. Based on these results, we confirmed that the embryonic development of C. gigas is associated with IGF-I activity.


Keywords: Crassostrea gigas, Pacific oyster, Embryogenesis, Insulin-like growth factor

Ⅰ. 서 론

인슐린유사성장인자(insulin like growth fator, IGF)는 척추동물의 혈액 내에 IGF-결합단백질(IGF-Binding Proteins, IGFBPs)과 결합하여 존재하며, 성장호르몬을 매개로 생성되어 성장과 생존에 영향을 미치는 것으로 알려져 있다(Wood et al, 2005). 특히 IGF-I과 IGF-II는 포유류와 어류의 세포 조직 내에서 배발생과 성장을 촉진하는 역할을 담당한다(Duan, 1997; Louvi A et al., 1997).

현재 IGF가 수산생물에서 배발생 과정에 미치는 영향에 관해서는 zebrafish, Danio rerio의 배발생 동안 IGF signaling에 관한 연구(Schlueter et al., 2007), 무지개송어, Oncorhynchus mykiss에서는 IGF와 관련된 유전자에 대한 연구(Li et al., 2010), 넙치, Paralichthys olivaceus에서는 IGF와 단백질 발현양의 변화(Kim et al., 2018)와 비텔로제닌의 발현시기와의 상관관계에 관한 연구(Park et al., 2019) 등 어류에서 주로 연구가 진행되어왔다. 그러나, 무척추동물에서는 전통적인 IGF, IGFBP가 존재하는지에 대한 명확한 증거는 없지만, 다량의 인슐린유사펩티드(insulin-related peptide, IRP)가 발현되고 있다(Smit et al., 1998). 특히, 연체동물의 인슐린관련펩티드 MIP(molluscan insulin-related peptide), CIR(Crassostrea gigas insulin-related peptide receptor)등이 보고되고 있다(Gricourt et al., 2003).

참굴, Crassostrea gigas은 수출량이 꾸준히 증가하는 주요 양식종으로(FAO, 2018), 지속적인 양식을 위해서는 안정적인 종묘확보가 무엇보다도 중요하다. 참굴의 자연종묘생산은 해황의 변동에 따라 종묘 생산량의 변동이 심하고 안정적이지 못할 뿐만 아니라, 질적 수준이 저하될 수 있는 문제점이 있으며, 이러한 문제를 해결하기 위해 인공종묘생산에 관한 연구가 진행되고 있다(NIFS, 2016). 특히 이 과정에서 수정과 정상적인 배발생은 초기 종묘생산량과 연결되어 매우 중요하며, 이 때 IGF-I은 초기 배발생 과정을 조절하는 주요한 인자로 작용한다(Chandra et al., 2011). 따라서 본 연구에서는 참굴의 미수정란을 비롯한 수정란의 발생이 진행되는 동안 발생 단계에 따른 IGF-I과 IGF-IR(IGF-I receptor)의 단백질 발현과 MIP, CIR, IGFBP-ALS(Insulin-like growth factor-binding protein complex acid labile submit) mRNA의 발현을 비교하여 참굴의 배발생 과정에 미치는 영향을 조사하였다.


Ⅱ. 연구 방법
1. 인공수정

인공수정을 위한 채란·채정용 어미는 통영 자란만(34°51′32.34″ N, 128°12′23.44″ E)에서 양성중인 참굴 모패를 사용하였다(<Table 1>). 참굴의 알은 난핵포붕괴 이전에도 수정이 가능하므로, 성숙한 암수 생식소 부위를 절개하여 암수 5:1의 비율로 각각 알과 정자를 채란·채정한 후, 미리 준비해 둔 여과해수(23℃)에 넣어 수정하여 세란하였다.

<Table 1> 
Adult shells of Crassostrea gigas used for the collection of eggs and sperm
Sex No. Shell length(mm) Shell height(mm) Shell width(mm) Total Weight(g)
Female 45 51.1±5.2 111.4±18.9 30.9±408 77.5±20.8
Male 9 54.7±7.1 118.5±13.8 33.0±3.2 86.8±34.4
Average 52.9±1.4 115.0±3.6 31.9±1.2 82.1±9.6

2. 배발생

발생수온은 23℃(±0.3)를 유지하였으며, 20 L 수조(n=3)에 수용한 다음, 수정란, 포배기, 낭배기, 트로코포아 및 D형유생에 도달하는 시간을 조사하였다. 각 발생단계에 따라 Motic Image Plus 2.0(Motic Instruments Inc, China)을 이용하여 0.1 µm까지 측정하였다. 수정여부는 제 1 극체가 방출된 알로 판단하였으며, 발생단계의 구분은 각 단계에서 80% 이상의 발달이 진행되었을 때로 하였고, 3개의 수조에서 각 단계별 500 µL(미수정란; 약 700±10, 수정란; 750±5, 포배기; 650±10, 낭배기; 650±10, 트로코포아; 550±10, D형유생; 450±5개체)씩 채취하였다.

3. Western blot 분석

참굴의 각 발생단계에 따른 IGF-I의 발현을 확인하기 위해 immunoblot assay를 실시하였다.

발생단계별 500 µL씩(평균 625±8개체) RIPA buffer(50 mM Tris, 1 mM EGTA, 150 mM Nacl, 1% NP-40, 0.25% Na-deoxycholate) 1 mL에 넣고 균질화한 다음, 12000 rpm에서 15분간 원심분리하여 상층액을 분리하였다. 단백질 농도는 BCA protein assay kit(Thermo, #23225)를 사용하여 microplate reader(EZ Read 400, Biochrom, UK)에서 562 nm로 측정하였다. 50 µg의 단백질을 8-15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis(SDS-PAGE)로 분리하고, polyvinylidene fluoride(PVDF) membrane으로 옮겼다. PVDF membrane은 tris buffered saline with Tween-20(TBST)에 용해된 10% bovine serum albumin(BSA)에서 1시간동안 실온에서 반응시켰다. 1차 항체는 IGF-I, IGF-IR, tyrosine-phosphorylation(P-Tyr)과 β-actin을 1:1000의 비율로 희석하여 사용하였으며, 실험에 사용한 항체는 모두 Santa Cruz Biotechnology(Santa Cruz, CA, USA)을 사용하였다. 2차 항체는 Goat anti-mouse IgG, (H+L) horceradish peroxidase conjugated(Thermo, #31430)를 1:10,000의 비율로 희석하여 사용하였다. Densitometry는 Gene Tools version 4.03(SYNGENE, Cambridge, UK)을 이용하여 확인하였다.

4. Total RNA 추출 및 cDNA 합성

Total RNA 추출은 Trans Zol UP(TransGen Biotech, Beijing, China)을 이용하여 분리하였고, cDNA 합성은 total RNA를 주형으로 Prime Script First cDNA Synthesis Kit(TaKaRa Bio, Shiga, Japan)을 사용하여 합성하였다.

5. Real time quantitative polymerase chain reaction(Real time qPCR)

각 유전자들의 발현은 real time qPCR을 사용하여 정량분석하였다. 분석은 TB Green Premix ExTaq II(TaKaRa Bio, Shiga, Japen)를 사용하였으며, Thermal Cycler Dice Real Time System을 사용하여 PCR을 수행하였다. PCR에 사용된 primer는 Moon and Choi(2019)에 따라 <Table 1>에 나타내었다. PCR증폭은 95℃ 30초, 60℃ 30초 및 72℃ 30초로 총 30회 수행되도록 하였으며, 최초 변성 반응은 95℃ 5분을 실시하였다. 또한 각 cDNA별로 3회 반복 증폭 시험을 실시하였다. 각 유전자의 발현은 EF1α(Elongation factor 1 alpha)의 상대정량을 통해 분석하였다.

<Table 2> 
Oligonucleotide sequences of primers for the real time qPCR assay
Primer name Sequence(5’-3’) Amplicon size(bp) GenBank#
EF1α (F)GAAGGAAGCTGAGATGGG 776 AB122066.1
(R)GCCTCTGGGAGAGATTCGTG
CIR (F)CAAGACAGGGGAGGTGATCG 537 AJ535669.1
(R)TACAGGTCCCTAGCAACCCC
IGFBP-ALS (F)AGATGCAGCCTAGGAGGGTC 380 XM_011417921.2
(R)CTGAACGTGATGGACACCGGA
MIP (F)CAAGATCCGCTCCCTGGAAG 198 NM_001308866.1
(R)CCTCAAACTCCGCCACACTG
PCR polymerase chain reaction. F, forward; R, reverse; EF1α, Elongation factor 1 alpha; CIR, Crassostrea gigas insulin-related peptide receptor; IGFBP-ALS, Insulin-like growth factor-binding protein complex acid labile submit; MIP, Molluscan insulin-related peptide 3-like.

6. 통계 분석

실험의 분석결과는 SPSS 프로그램(Statistical Package for Social Science, SPSS Inc, Chicago, IL, USA)을 이용하여 처리하였고, one-way ANOVA test를 실시하여 Duncan’s multiple range test(Duncan, 1955)로 유의성을 검증하였다.


Ⅲ. 연구 결과 및 고찰
1. 참굴 배발생

본 연구에서 발생수온은 Chang et al.(2000)에 의한 연구결과에서 제시된 적정수온인 20~25℃의 평균값인 23℃(±0.3)로 설정하였다. 참굴의 수정란은 60.1±3.2 µm, 포배기 56.3±3.5 µm, 낭배기 49.8±3.3 µm, 트로코포아 54.0±11.2 µm 및 D형 유생은 각장 46.5±2.6 µm, 각고 50.9±10.5 µm였다([Fig 1]). 수온 23℃(±0.3)에서, 각각의 발생 소요시간은 수정란에서 포배기에 이르기까지 6시간 30분, 낭배기에는 14시간 35분, 트로코포아까지 22시간 30분, D형 유생까지는 28시간이 소요되는 것으로 나타났다. 본 연구 보다 낮은 수온인 21℃(±1.0)에서 참굴을 발생시킨 Hur and Hur(2000)의 연구결과에서는 수정란에서 포배기에 이르는 시간이 5시간, 낭배기에 이르는 시간이 7시간, 트로코포아에 이르는 시간이 10시간, D형유생까지 23시간 55분으로 나타났다. 또한, 참굴을 20℃와 25℃에서 각각 배발생시킨 Chang et al.(2000)의 연구결과에서는 수정란에서 트로코포아에 이르는 시간이 각각 12시간 50분과 9시간 13분, D형유생까지는 26시간 17분과 17시간 35분으로 나타났다. 본 연구와 비슷한 수온인 23~24℃의 수온에서 발생시킨 Li et al.(2019)의 연구결과에서는 트로코포아에 이르는 시간이 12시간, D형유생까지 24시간으로 나타났다. 본 연구에서 사용된 사육수의 수온이 20℃(Hur and Hur, 2000)와 21℃(Chang et al., 2000)보다 높은 23℃(±0.3)이고, 23~24℃(Li et al., 2019)와는 비슷한 수온임에도 불구하고 발생시간이 많이 소요되었다. 이러한 이유는 유생이 발달하는 시기에 먹이공급의 부재와 난질에 따른 결과로 사료된다. 난질은 먹이 섭취 전 유생 단계뿐만 아니라 그 이후 발생 단계에 성장과 생존에도 영향을 미치기 때문이다(Wilson et al., 1996; Duan, 1997).


[Fig. 1] 
Developmental stages in Pacific oyster (Crassostrea gigas). Developmental stages: (a) Unfertilized egg, (b) Fertilized egg, (c) Blastula., (d) Gastrula, (e) Trochophore, (f) D-shaped larva. Scale bar=20 µm.

2. IGF 시스템의 발현

IGF 시스템은 리간드(ligand), IGF 수용체인 IGF-IR, IGF-결합단백질인 IGFBPs로 구성되어있으며(Duan, 1997), IGF-I는 세포분열촉진제로서 여러 형태의 세포에 걸쳐 세포증식을 자극하고, 세포의 분화와 세포기능의 발현에 관여한다(Maures et al., 2002). 본 연구에서, 참굴의 미수정란부터 D형유생까지 IGF-I 발현을 확인하기 위해 western blot으로 분석한 결과, 미수정란보다 수정란에서 유의하게 높은 값을 확인할 수 있었으며(P<0.05), 포배단계에서 가장 높은 값을 보인 후 다시 감소하였다([Fig. 2. a]).


[Fig. 2] 
Changes in protein expression during development in Pacific oyster(Crassostrea gigas). Western blot of (a) IGF-I, (b) IGF-I receptor and (c) Tyrosine-phosphorylation(PY99). UE, unfertilized egg; FE, fertilized egg; B, blastula; G, gastrula; T, trochophore; D, D-shaped larva. *P<0.05 compared with unfertilized egg(n=3).

이러한 결과는 starry flounder, Platichthys stellatus의 배발생에서도 동일하게 보고되었는데, 포배기까지 IGF-I의 발현이 높은 수준으로 유지된 후 다시 감소하였다(Xu et al., 2015). 한편, 본 연구결과 IGF-IR의 발현도 IGF-I의 발현과 유사한 경향을 보였으며([Fig. 2. a, b]), real time qPCR을 통한 MIP, IGFBP-ALS, IGF-IR mRNA의 발현도 IGF-I 발현과 비슷한 경향을 보였다([Fig. 3. a, b]). MIP mRNA 수준이 수정란에서는 수정 전 수컷 생식소와 암컷 생식소의 중간 정도의 발현값을 나타내었다. 이는 gilthead seabream, Sparus aurata(Perrot et al., 1999)과 zebrafish, D. rerio(Schlueter et al., 2007)에서 수정란의 IGF-I mRNA가 수정 전 암컷 생식소와 수컷 생식소로부터 유전되었다는 연구결과와 유사하였다. 또한 gilthead seabream, S. aurata에서도 mRNA수준에서 IGF-I과 IGF-IR의 발현이 동일하게 나타나며 발육초기에 IGF-I이 성장 촉진 역할을 하는 것으로 보고된 바 있다(Perrot et al., 1999). Starry flounder, P. stellatus의 배발생에서 IGF-I mRNA 수준은 포배기까지 높게 유지하다가 낭배기에서 유의하게 감소하였다(Xu et al., 2015). 본 연구에서도 포배기에서 높은 수준으로 나타나는 것을 볼 수 있었으며, 운동성이 나타나는 트로코포아단계에서 유의하게 높은 값을 보였다. IGF-IR의 결합에 의한 자가인산화 반응은 배발생을 촉진시키며(Duan and Xu, 2005), IGF-IR의 인산화는 하위시그널의 연속적인 반응을 야기한다(Jones and Clemmons, 1995). 본 연구 결과에서 IGF-IR의 활성화를 확인하기 위해 phospho-tyrosine의 발현을 조사한 결과, 발생이 이루어지는 수정란부터 D형유생까지 관찰할 수 있었으며, 수정란과 포배기에서 유의하게 높은 값을 보였다(P<0.05)([Fig. 2. c]). IGF-I의 신호전달이 zebrafish, D. rerio의 배발생동안 정상적인 발달에 결정적인 역할을 하는 것으로 보고되고 있다(Zou et al., 2009). 본 연구결과, 포배기에서 IGF-I의 높은 발현은 수정란에서 포배기로 세포분열이 활발하게 일어나는 시기에 IGF-I이 세포분화에 작용하기 때문이다(Pozios et al., 2001). 본 연구에서 참굴의 발생이 진행되어 유생단계에 이르렀을 때 IGF-I과 IGF-IR의 발현이 감소하였는데, 이는 발생소요시간 지연과 관련된 난질의 영향과 유생단계부터 공급되는 영양 상태에 의한 것으로 보인다. IGF-I의 발현 양상은 영양 상태와 관련이 있으며(Duan, 1998), 환경의 변화에 따라 달라질 수 있기 때문이다(Wilson et al., 1996; Duan, 1997).


[Fig. 3] 
Expression of molluscan insulin –related peptide 3-like(MIP), insulin-like growth factor-binding protein complex acid labile submit (IGFBP-ALS) and Crassostrea gigas insulin-related peptide receptor(CIR) mRNA in Pacific oyster(Crassostrea gigas). The mRNA expression of elongation factor 1 alpha(EF1α). MG, male gonad; FG, female gonad; FE, fertilized egg; B, blastula; G, gastrula; T, trochophore; D, D-shaped larva. *P<0.05(n=3).


Ⅳ. 결 론

본 연구는 참굴의 배발생이 이루어지는 동안 성장단계별 IGF시스템의 발현값을 비교하기 위해 미수정란, 수정란, 포배기, 낭배기, 트로코포아, D형유생을 실험에 사용하였다. Western blot을 통해서 IGF-I, IGF-IR, phospho-tyrosine의 발현양을 조사하였으며 real time qPCR을 이용하여 MIP, IGFBP-ALS, IGF-IR의 mRNA 수준을 확인하였다. 미수정란에서 수정란이 되었을 때에 IGF-I, IGF-IR와 phospho-tyrosine의 발현이 급격히 증가하였으며, 이러한 결과는 MIP mRNA 수준에서도 유사하게 나타났다. 그러나 D형유생으로 갈수록 감소하는 경향이 나타났다. 따라서, 참굴의 수정이 이루어지는 단계부터 D형유생까지 IGF 시스템의 활성이 발생에 영향을 미치는 것으로 사료되며, 향후 먹이공급을 시작하는 D형유생 이후부터 모패에 이르기까지 각 단계별 IGF 시스템의 발현에 관한 연구가 필요할 것으로 사료된다.


Acknowledgments

이 논문은 2016년도 정부(교육부)의 재원으로 한국연구재단의 지원을 받아 수행된 기초연구 사업임(No. NRF-2016R1D1A1B03934914).


References
1. Chandra V, Kumar GS and Sharma GT(2011). Temporal expression pattern of insulin-like growth factors(IGF-1 and IGF-2) ligands and their receptors(IGF-1R and IGF-2R) in buffalo(Bubalus bubalis) embryos produced in vitro. Livestock Science 135, 225~230.
2. Chang YJ, Choi YH, Chang YJ and Choi SW(2000). Effect of water temperature on the egg development of pearl oyster, Pinctada fucata martensii and Pacific oyster, Crassostrea gigas. J Korean Fish Soc 33, 559~564.
3. Duan C(1997). The insulin-like growth factor system and its biological actions in fish. Amer Zool 37, 491~503.
4. Duan C(1998). Nutritional and developmental regulation of insulin-like growth factors in fish. J Nutr 128, 306~314.
5. Duan C and Xu Q(2005). Roles of insulin-like growth factor(IGF) binding proteins in regulating IGF actions. Gen Comp Endocrinol 142, 44~52.
6. Duncan DB(1955). Multiple range and multiple F tests. Biometrics 11, 1~42.
7. FAO(2018). The status of world fisheries and aquaculture 2018. Meeting the sustainable development goals. Licence: CC BY-NC-SA 3,0 IGO. Food and Agriculture Organization of the United Nations, Rome.
8. Gricourt L, Bonnec G, Boujard D, Mathieu M and Kellner K(2003). Insulin-like system and growth regulation in the Pacific oyster Crassostrea gigas: hrIGF-1 effect on protein synthesis of mantle edge cells and expression of an homologous insulin receptor-related receptor. Gen Comp Endocrinol 134, 44~56.
9. Hur YB and Hur SB(2000). Development and growth of larvae of four bivalve species. Journal of Aquaculture 13, 119~128.
10. Jones JI and Clemmons DR(1995). Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16, 3~34.
11. Kim KW, Nam TJ and Choi YH(2018). Protein variation and involvement of insulin-like growth factor during embryonic development in the olive flounder Paralichthys olivaceus. Fisheries and Aquatic Sciences 21, 4~8.
12. Li M, Bureau DP, King WA and Leatherland JF(2010). The actions of in ovo cortisol on egg fertility, embryo development and the expression of growth‐related genes in rainbow trout embryos, and the growth performance of juveniles. Mol Reprod Dev 77, 922~931.
13. Li H, Li Q, Yu H and Du S(2019). Developmental dynamics of myogenesis in Pacific oyster Crassostrea gigas. Comp Biochem Physiol B Biochem Mol Biol 227, 21~30.
14. Louvi A, Accili D and Efstratiadis A(1997). Growth-promoting interaction of IGF-II with the insulin receptor during mouse embryonic development. Developmental Biology 189, 33~48.
15. Maures T, Chan SJ, Xu B, Sun H, Ding J and Duan C(2002). Structural, biochemical, and expression analysis of two distinct insulin-like growth factor I receptors and their ligands in zebrafish. Endocrinol 143, 1858~1871.
16. Moon JS and Choi YH(2019). Multiplex PCR for the rapid detection of insulin-like growth factor in the Pacific oyster, Crassostrea gigas: a useful indicator for growth assessment. Mol Biol Rep 46, 1023~1031.
17. NIFS(2016). Standard manual of Pacific oyster culture. National Institute of Fisheries Science, Korea. [in Korean]
18. Park SJ, Moon JS, Seo JS and Choi YH(2019). The expression of insulin-like growth factor and vitellogenin during embryonic development in the olive flounder(Paralichthys olivaceus). JFMSE 31, 418~425.
19. Perrot V, Moiseeva EB, Gozes Y, Chan SJ, Ingleton P and Funkenstein B(1999). Ontogeny of the insulin-like growth factor system(IGF-I, IGF-II and IGF-IR) in gilthead seabream(Sparus aurata): expression and cellular localization. Gen Comp Endocrinol 116, 445~460.
20. Pozios KC, Ding J, Degger B, Upton Z and Duan C(2001). IGFs stimulate zebrafish cell proliferation by activating MAP kinase and PI3-kinase-signaling pathways. Am J Physiol Regul Integr Comp Physiol 280, 1230~1239.
21. Schlueter PJ, Peng G, Westerfield M and Duan C(2007). Insulin-like growth factor signaling regulates zebrafish embryonic growth and development by promoting cell survival and cell cycle progression. Cell Death Differ 14, 1095~1105.
22. Smit AB, Vankesteren RE, Li KW, Vanminnen J, Spijker S, Van Heerikhuizen H and Geraerts WPM(1998). Towards understanding the role of insulin in the brain: lessons from insulin-related signaling systems in the invertebrate brain. Prog Neurobiol 54, 35~54.
23. Wilson JA, Chaparroa OR and Thompson RJ(1996). The importance of broodstock nutrition on the viability of larvae and spat in the chilean oyster Ostrea chilensis. Aquaculture 139, 63~75.
24. Wood AW, Duan C and Bern HA(2005). Insulin-like growth factor signaling in fish. Int Rev Cytol 243, 215~285.
25. Xu Y, Zang K, Liu X, Shi B, Li C and Shi X(2015). Insulin-like growth factors I and II in starry flounder(Platichthys stellatus): molecular cloning and differential expression during embryonic development. Fish Physiol Biochem 41, 139~152.
26. Zou S, Kamei H, Modi Z and Duan C(2009). Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development. PLoS One 4, e7026. 1~12